View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3803_low_1 (Length: 848)
Name: NF3803_low_1
Description: NF3803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3803_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 20 - 237
Target Start/End: Complemental strand, 32093006 - 32092789
Alignment:
| Q |
20 |
cacagcataattccttccaaagaagcaaagaagaaaaaacaagaagctccggtgtatttcattccgttcatcagatgagcactccggcggagtggttgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32093006 |
cacagcataattccttccaaagaagcaaagaagaaaaaacaagaagctccggtgtatttcattccgttcatcagatgagcactccggcggagtggttgaa |
32092907 |
T |
|
| Q |
120 |
ttccgtaggtgttttccacgatggcgatgacggaggagagtgtccatgagatacggatgtagaagatgagaagggagagtgcaaggacgaggatggcgga |
219 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32092906 |
ttccgtaggtgttttccactatggcgatgacggaggagagtgtccatgagatacggatgtagaagatgagaagggagagtgcaagaacgaggatggcgga |
32092807 |
T |
|
| Q |
220 |
gacggtgcgaatgatttc |
237 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
32092806 |
gacagtgcgaatgatttc |
32092789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 131; E-Value: 2e-67
Query Start/End: Original strand, 686 - 840
Target Start/End: Complemental strand, 32092337 - 32092188
Alignment:
| Q |
686 |
tgacgggagtgagcgttgatgattcgtttggattcagagaggatggaccatagtttaaggctggctattgatgtagttgttgacatgcttgttgcgttgc |
785 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32092337 |
tgacgggagtgagcgttgatgattcgtttggattcagagaggatggaccatagtttcaggctggctattgatgtagttgttgacatgcttgttgcgttgc |
32092238 |
T |
|
| Q |
786 |
gttgcgttgctatcttgagactcaaatggtggaaggagagatactgatgatgatg |
840 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32092237 |
g-----ttgctatcttgagactcaaatggtggaaggagagatactgatgatgatg |
32092188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 365 - 418
Target Start/End: Complemental strand, 32092661 - 32092608
Alignment:
| Q |
365 |
agtttgacgggacggccgaagaagccgtggaagacgctgtgggtgatggtggct |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32092661 |
agtttgacgggacggccgaagaagccgtggaagacgctgtgggtgatggtggct |
32092608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 498 - 571
Target Start/End: Complemental strand, 32092528 - 32092452
Alignment:
| Q |
498 |
tggttgttttaggtgtaaatctgatatcttct---gtgcgcaactgcagagaccgtaaagacgttgcttgacgaaga |
571 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
32092528 |
tggttgttttaggtgtaaacctgatatcttcttctgtgcgcaactgcagagacagtagagacgttgcttgacgaaga |
32092452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University