View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3803_low_15 (Length: 266)
Name: NF3803_low_15
Description: NF3803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3803_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 25371953 - 25371719
Alignment:
| Q |
1 |
cgccattctcttctgcctcctctcaatagtcttttccatcatctcatctgaatacttgtgcttccttccaacgccgctgccaccagcacctccctttgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25371953 |
cgccattctcttctgcctcctctcaatagtcttttccatcatctcatctgaatacttgtgcttccttccaacgccactgccaccagcacctccctttgaa |
25371854 |
T |
 |
| Q |
101 |
tctgaacatgtagatgataaatgcgttgtcgttgccccgattggtatttttgaataaccaatctccataagtttgttctcataaaccgaattagcaacac |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25371853 |
tctgcacatgtagatgataaatgcgttgtcgttgccccgattggtatttctgaataaccaatttccataagtttgttctcataaaccgaattagcaacac |
25371754 |
T |
 |
| Q |
201 |
cgaaatctggacacaaccctatcatccgttgattt |
235 |
Q |
| |
|
||||||| ||||||| ||||| ||| |||||||| |
|
|
| T |
25371753 |
cgaaatccggacacattcctattatcggttgattt |
25371719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University