View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3803_low_20 (Length: 244)
Name: NF3803_low_20
Description: NF3803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3803_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 16960622 - 16960848
Alignment:
| Q |
1 |
ttttttcgatgaacctgatttacaaccaagataacaactccaacaatcaataatccaacaactcctatgcatgatgatacaattactgctttactagttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||| || ||| |
|
|
| T |
16960622 |
ttttttcgatgaacctgatttacaaccaagataacaactccaacaatcaataatccaacaactcctatgcttgatgaaacaactactgctttgcttattg |
16960721 |
T |
|
| Q |
101 |
ttcccttatgcttctgttgttgacgaggcgtaatattcaccgctaaagcttcactgctgcagaaattgtaactatgctgatcttgtttctcgtttgataa |
200 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16960722 |
ttcccttatgcttctgttgtcgatgaggcgagatattcaccgctaaagcttcactgctgcagaaattgtaactatgctgatcttgtttctcatttgataa |
16960821 |
T |
|
| Q |
201 |
acaatttctagcatacaaaacaactct |
227 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
16960822 |
acaattcctagcatacaaaacaactct |
16960848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University