View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3803_low_24 (Length: 235)
Name: NF3803_low_24
Description: NF3803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3803_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 21789510 - 21789730
Alignment:
| Q |
1 |
catagttgattagaatgagtggtgaagcataaaccaatttgaaccagcagtgtgtccaaaacccatttg-ttttaggtgcgtccagaaatagttgttctg |
99 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
21789510 |
catagttgattagaatgagtggtgaaggataaaccaatttgaacccgcagtgtgtccaaaatccatttgattttaggtgcgtccagata-agttgttctg |
21789608 |
T |
 |
| Q |
100 |
gcacagcttcgtcatccaacgaagacaaactattctaataaacttaatcataattgtagtattgaaaatcattgtgataactttattttttaggataata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21789609 |
gcacagcttcgtcatccaacgaagacaaactattctaataaacttaatcataattgtagtattgaaaatcattgtgataactttattttttaggataata |
21789708 |
T |
 |
| Q |
200 |
tatcttaatctcttgttatttt |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
21789709 |
tatcttaatctcttgttatttt |
21789730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University