View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3803_low_26 (Length: 234)
Name: NF3803_low_26
Description: NF3803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3803_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 23128479 - 23128699
Alignment:
| Q |
1 |
aacaaatttgttcacgtactctttcaccttcaattcatgattcgttaaccattcttctccgagaagaatccctagattcgatcttcgaacctttacgacg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23128479 |
aacaaatttgttcacatactctttcaccttcaattcatgatttgttaaccattcttctccgagaagaaaccctagattcgatcttcgaacctttacgacg |
23128578 |
T |
|
| Q |
101 |
acgtattgcatgttatttgcgagaaaaagataagaaagtgctacgtctttgtagaattcagcttttgtatcgagtttgcagagaagaacaagtatcagcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23128579 |
acgtattgcatgttatttgcgagaaaaagataagaaagtgctacgtctttgtagaattcagcttttgtatcgagtttgcagagaagaacaagtatcagcc |
23128678 |
T |
|
| Q |
201 |
acgcgattttttctgatatct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23128679 |
acgcgattttttctgatatct |
23128699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 41102699 - 41102867
Alignment:
| Q |
17 |
tactctttcaccttcaattcatgattcgttaaccattcttctccgagaagaatccctagattcgatcttcgaacctttacgacgacgtattgcatgttat |
116 |
Q |
| |
|
|||||||| ||||||| ||| || ||| |||||| || || ||||||| || || |||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
41102699 |
tactctttaaccttcatttcgtgtttcaataaccaatcctcgccgagaataaaccttagattcgatttacgaacctttacgacgacgtattgcatgttat |
41102798 |
T |
|
| Q |
117 |
ttgcgagaaaaagataagaaagtgctacgtctttgtagaattcagcttttgtatcgagtttgcagagaa |
185 |
Q |
| |
|
| |||||||||||||| |||||||| ||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
41102799 |
tcgcgagaaaaagatacgaaagtgcaacgtctttgtaaaactcagctttaccgtcgagtttgcagagaa |
41102867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University