View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3804_high_25 (Length: 410)

Name: NF3804_high_25
Description: NF3804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3804_high_25
NF3804_high_25
[»] chr4 (2 HSPs)
chr4 (22-229)||(7453838-7454045)
chr4 (275-347)||(7454091-7454163)
[»] chr3 (1 HSPs)
chr3 (349-410)||(36795654-36795715)
[»] chr5 (1 HSPs)
chr5 (276-321)||(1360310-1360356)


Alignment Details
Target: chr4 (Bit Score: 168; Significance: 6e-90; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 22 - 229
Target Start/End: Original strand, 7453838 - 7454045
Alignment:
22 ttcaaaccagaaaatcgttcagattcaatttctccaactacaaccaccataccgtcctcgacggccgccacctgatgaaacgcacagatccactattaaa 121  Q
    ||||||||||||||||||||| |||||||||||||   ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
7453838 ttcaaaccagaaaatcgttcaaattcaatttctccgcatacaaccaccataccgtcctcaacggccgccacctgatgaaacgcacagatccactattaaa 7453937  T
122 gaacaaatatgtgcgtatggttgccggtgagagttgcagatgagagagtgataaaaagaggaagagggaggtgtttgcaaatgagaaaggggaaagtgat 221  Q
    ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||    
7453938 gaacatatatgtgcgtatggtcgccggtgagagttgcagatgagagagtgataaaaagaggaagaggaaggtgtttgaaaatgagaaaggggagagtgat 7454037  T
222 gtacgtga 229  Q
    ||||||||    
7454038 gtacgtga 7454045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 275 - 347
Target Start/End: Original strand, 7454091 - 7454163
Alignment:
275 tagagtataggtgaacagtaaatacgatgatatcgtatttgtgtctgnnnnnnngtgtctatttatcatttct 347  Q
    |||||||||||||||||||||||||| || | |||||||||||||||       ||||| |||||||||||||    
7454091 tagagtataggtgaacagtaaatacggtgctgtcgtatttgtgtctgtttttttgtgtccatttatcatttct 7454163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 349 - 410
Target Start/End: Complemental strand, 36795715 - 36795654
Alignment:
349 ttcaattaattgcaaaacaattacttgcaacaattatctcttcaaatatttaatagcacaac 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36795715 ttcaattaattgcaaaacaattacttgcaacaattatctcttcaaatatttaatagcacaac 36795654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 276 - 321
Target Start/End: Original strand, 1360310 - 1360356
Alignment:
276 agagtataggtgaacagt-aaatacgatgatatcgtatttgtgtctg 321  Q
    |||||||||||||||||| ||||||| |||| |||||||||||||||    
1360310 agagtataggtgaacagtaaaatacggtgatgtcgtatttgtgtctg 1360356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University