View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3804_high_48 (Length: 250)
Name: NF3804_high_48
Description: NF3804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3804_high_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 31056287 - 31056534
Alignment:
| Q |
1 |
ttatcttaatctaatcaagttaccgcaaccttgatcatgcagtagaggaaggtatttgtcaggttatttcttacatgtggcttgaagcagaagttatgtc |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31056287 |
ttatcttaatctaatcaggttaccgcaaccttgatcctgcagtagaggaaggtatttgtcaggttctttcttacatgtggcttgaagcagaagttatgtc |
31056386 |
T |
|
| Q |
101 |
gggttctagaaccatggcatcaacatcagccgcag---nnnnnnnnnnnnnnnnnacctccacctcctactcctcaaagaaaggtgcgatatccaaagtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31056387 |
gggttctagaaccatggcatcaacatcagccgcagcttcttcttcttcttcttctacctccacctcctactcatcaaagaaaggtgcgatatccaaagtt |
31056486 |
T |
|
| Q |
198 |
gagaataaattgggtgaatttttcatgaaccagattgcctatgcttct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
31056487 |
gagaataaattgggtgaatttttcatgaaccagattgccaatgattct |
31056534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University