View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3804_low_27 (Length: 409)
Name: NF3804_low_27
Description: NF3804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3804_low_27 |
 | |
|
| [»] scaffold0768 (1 HSPs) |
| | |
|
| [»] scaffold1847 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0768 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: scaffold0768
Description:
Target: scaffold0768; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 136 - 390
Target Start/End: Original strand, 5 - 256
Alignment:
| Q |
136 |
cgccggtgaaagtgctctgatcataaaatgcgaataaagatttttgcatgagatattaggtgcaaaggtggataaaatcctaagacttgtgttatttttg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
5 |
cgccggtgaaagtgctctgatcataaaatgcaaataaagatttttgcatgagatattaggtgcaaaggtggataaaatcctaagacgtgtgttaagattg |
104 |
T |
|
| Q |
236 |
tttcttaagaaaagtttttggtgaattaggctttgatactattattgataaaggtgaacaagtttctaacaatttgttaccatattgttctgtaacttga |
335 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
105 |
tttcttaagaaaagttgttaatgaattaggctttgatac---tattgataaaggtgaacaagtttctaacaatttgttaccatattgttctgtaacttga |
201 |
T |
|
| Q |
336 |
tcatggcaaggttaagttatatctaaaggaggaagatttattattgagagaaaaa |
390 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
202 |
tcatggcaaggttaagttatatataaaggaggaagatatattattgagagaaaaa |
256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1847 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: scaffold1847
Description:
Target: scaffold1847; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 1202 - 1301
Alignment:
| Q |
1 |
cctagaggtataggcgggagctgcaaactccggcagcggggaattatggtgtttctcagtcacaaccatgacatccgctattggggtaatatctagcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1202 |
cctagaggtataggcgggagctgcaaactccggcagcggtgaattatggtgttttttagtcacaaccatgacatccgctattggggtaatatctagcatg |
1301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 353 - 391
Target Start/End: Complemental strand, 6845868 - 6845830
Alignment:
| Q |
353 |
tatatctaaaggaggaagatttattattgagagaaaaaa |
391 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6845868 |
tatatataaaggaggaagatttattattgagagaaaaaa |
6845830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University