View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3804_low_46 (Length: 259)
Name: NF3804_low_46
Description: NF3804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3804_low_46 |
 | |
|
| [»] scaffold0722 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0722 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: scaffold0722
Description:
Target: scaffold0722; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 2178 - 2037
Alignment:
| Q |
17 |
taaacatcctaatcttttgccactttctggatactgcatcgcaggtaatcattttctatgcgttt-tttaatctatgtagcatcgacatttttgataaaa |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2178 |
taaacatcccaatcttttgccactttctggttactgcatcgcaggtaatcattttctatgcgtttatttaatctatgtaacatcgacacttttgataaaa |
2079 |
T |
|
| Q |
116 |
gatatatctaatatccgagacatatttgatatcaacacgaca |
157 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2078 |
gatatatctaatatcagagacatatttgatatcaacacgaca |
2037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0722; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 201
Target Start/End: Complemental strand, 2004 - 1969
Alignment:
| Q |
166 |
ttgatttcaaattattatcggtgttaaatgtattag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2004 |
ttgatttcaaattattatcggtgttaaatgtattag |
1969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University