View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3804_low_65 (Length: 235)
Name: NF3804_low_65
Description: NF3804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3804_low_65 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 45694651 - 45694872
Alignment:
| Q |
1 |
agaacttgattggaagtttgatcaactttggatacatcttctttgcaagcagaagtagaaacagtagtgtttttctcaagagatttcggctccaaaggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45694651 |
agaacttgattggaagtttgatcaactttggatacatcttctttgcaagcagaagtagaaacagtagtgtttttctcaagagatttcggctccaaaggtt |
45694750 |
T |
|
| Q |
101 |
tcaaaccaaccctggatggctctactgactgatgacaatgtatggctgaactctttggacattctccacttaaatcaacttttgatgattcgcaaggatt |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45694751 |
tcaaaccaaccctggatggctccactgactgatgacaatgtatggctgaactctttggacattctacacttaaatcaacttttgatgattcgcaaggatt |
45694850 |
T |
|
| Q |
201 |
ccttcctattgcagctgcatct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45694851 |
ccttcctattgcagctgcatct |
45694872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 76 - 125
Target Start/End: Complemental strand, 37934670 - 37934621
Alignment:
| Q |
76 |
tcaagagatttcggctccaaaggtttcaaaccaaccctggatggctctac |
125 |
Q |
| |
|
||||| |||||||||| ||||||||||||| || || ||||||||||||| |
|
|
| T |
37934670 |
tcaagcgatttcggctgcaaaggtttcaaatcagccttggatggctctac |
37934621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University