View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3804_low_66 (Length: 229)
Name: NF3804_low_66
Description: NF3804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3804_low_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 31055839 - 31056052
Alignment:
| Q |
1 |
agttacagctattcttgttctctatggtcttccgaggtaattaatatttaatacacaacaatggaaacttctctttttgtctctctccaattacggatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31055839 |
agttacagctattcttgttctctatggtcttccgaggtaattaatatttaatacacaacaatggaaacttctctttttgtctctctccaattacagatga |
31055938 |
T |
|
| Q |
101 |
tccactttgnnnnnnnnttagtacctatgaattttgagaaatgatattaagtttcgataacaatttagatggttaacgctgttcaaaccatccactcaac |
200 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31055939 |
tccactttgaaaaaaaattagtatctatgaattttgagaaatgatgttaagtttcgataacaatttagatggttaacgctgttcaaaccatccactcaag |
31056038 |
T |
|
| Q |
201 |
gcaattaaccacag |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31056039 |
gcaattaaccacag |
31056052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University