View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3804_low_67 (Length: 227)
Name: NF3804_low_67
Description: NF3804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3804_low_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 5416102 - 5415885
Alignment:
| Q |
1 |
aattgattagcatattcactaaatacatttttggttctaaattcgtgagattcttctcattctcatgtgcgagtcaattcattcatttgggattacttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
5416102 |
aattgattagcatattcactaaatacatttttggttctaaattcgtgagattcttctcattctcatgtgcaagtcaattcattaatttgggattacttct |
5416003 |
T |
 |
| Q |
101 |
cctcgagcggtatt-ttttcatccacatttatttactctgccattgactcaacgggacacaatgcctaaccaacctattgtggtaaagattttcgataca |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5416002 |
cctcgagcggtatttttttcatccacatttatttactctgccattggctcaacgggacacaatgcctaaccaacccattgtggtaaagattttcgataca |
5415903 |
T |
 |
| Q |
200 |
aaaagttggtcacctttg |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5415902 |
aaaagttggtcacctttg |
5415885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University