View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3804_low_71 (Length: 219)
Name: NF3804_low_71
Description: NF3804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3804_low_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 22 - 164
Target Start/End: Complemental strand, 29206672 - 29206530
Alignment:
| Q |
22 |
tgtgcgcgcgcgcgtatgtgtgcaagcacattggaaatcttttatacagggagtatggtcgctaaactctttgaaacaaaatttcatatctgtagaattg |
121 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29206672 |
tgtgtgcgcgcgtgtatgtgtgcaagcacattggaaatcttttatgcagggagtatagtcgctaaactctttgaaacaaaatttcatatctgtagaattg |
29206573 |
T |
 |
| Q |
122 |
cactacatttggcaaagccggtctaatgataatcaatgtctaa |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29206572 |
cactacatttggcaaagccggtctaatgataatcaatgtctaa |
29206530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University