View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3805_high_22 (Length: 323)
Name: NF3805_high_22
Description: NF3805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3805_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 20 - 304
Target Start/End: Complemental strand, 27320388 - 27320104
Alignment:
| Q |
20 |
aagtcttgtcattggtgcttaattggatttttccgttcgcgccttcagctgtggcactggcttttggtttcctccagaaatttccaaaggacccttctat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27320388 |
aagtcttgtcattggtgcttaattggatttttccgttcgcgccttcagctgtggcactggcttttggtttcctccagaaatttccgaaggacccttctat |
27320289 |
T |
|
| Q |
120 |
ttcctccaatgttttgccctgtgtttcagggagcatagtgtagtgaaagatccacgcgacaattgcaatgcccgcaaaaagaaagaaagcgccaccaatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27320288 |
ttcctccaatgttttgccctgtgtttcagggagcatagtgtagtgaaagatccacgcgacaattgcaatgcccgcaaaaagaaagaaagcgccaccaatg |
27320189 |
T |
|
| Q |
220 |
gtgatggcgttggacagggacaggaaagtcatggagatgactccgctcgtgaccctattcaccaccgcaccaatagacacgcctt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27320188 |
gtgatggcgttggacagggacaggaaagtcatggagatgaccccgctcgtgaccctattcaccaccgcaccaatagacacgcctt |
27320104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University