View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3805_high_34 (Length: 264)
Name: NF3805_high_34
Description: NF3805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3805_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 4688155 - 4687901
Alignment:
| Q |
1 |
ttgatataccatttatgacttgtcaacattattccgtgtaattgcacacaaacttggcggcataagtt-gaaattaatattgatggtgctcttacctttt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4688155 |
ttgatataccatttatgacttgtcaacattattccgtgtaattgcacacaaacttggcggcataagttagaaattaatattgatggtgctcttacctttt |
4688056 |
T |
 |
| Q |
100 |
aatcaaagaattattcacgagattcctaagaaaatgacaaatcatagttttccaatgtttattgctaacnnnnnnnncttcttctttctaattacccacc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
4688055 |
aatcaaagaattattcacgagattcctaagaaaatgacaaatcatagttttccaatgtttattgttaaattttttttcttcttctttctaattacccacc |
4687956 |
T |
 |
| Q |
200 |
ataattaggattttagaccagtagatgttccaaaatgttttcatgggaccctttg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4687955 |
ataattaggattttagaccagtagatgttccaaaatgtttccatgggaccctttg |
4687901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University