View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3805_high_38 (Length: 234)
Name: NF3805_high_38
Description: NF3805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3805_high_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 33 - 220
Target Start/End: Complemental strand, 4688610 - 4688423
Alignment:
| Q |
33 |
aatcaacgattcaaaaattaataattgcaataaaaatacttgttaccnnnnnnnntaaagttgagaaaacatcccaacgtcacaccaatatatcgaatcg |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4688610 |
aatcaacgattcaaaaattaataattgcaataaaaatacttgttaccaaaaaaaataaagttgagaaaacatcccagcgtcacaccaatatatcgaatcg |
4688511 |
T |
|
| Q |
133 |
aatgtatttttacacaataccaacacctatggtttaattcaattatgtcattttctcaaataataattattgtttgttgtggtctctg |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4688510 |
aatgtatttttacacaataccaacacgtatggtttaatttaattatgtcattttctcaaataataattattgtttgttgtggtgtctg |
4688423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 206
Target Start/End: Complemental strand, 14664415 - 14664383
Alignment:
| Q |
174 |
attatgtcattttctcaaataataattattgtt |
206 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
14664415 |
attatttcattttctcaaataataattattgtt |
14664383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University