View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3805_low_18 (Length: 344)
Name: NF3805_low_18
Description: NF3805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3805_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 337
Target Start/End: Original strand, 48661120 - 48661456
Alignment:
| Q |
1 |
aaagtgttttcaaggttcggtgaagttactcaaggtgattaattataaatatattttgggtgttttcagagaggtactttctagatcatatttattttga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48661120 |
aaagtgttttcaatgttcggtgaagttactcaaggtaattaattataaatatattttgggtgttttcagagaggtactttctagatcatatttattttga |
48661219 |
T |
 |
| Q |
101 |
attaatggaacttcaagttttggaaatcttgagtctctaaggatcttcaatttgtattgctttatttcatgacagtcaagcttttgatagatnnnnnnnc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
48661220 |
attaatggaacttcaagttttggaaatcttgagtctctaaggatcttcaatttgtatttctttatttcatgacagtcaagcttttgatagataaaaaaac |
48661319 |
T |
 |
| Q |
201 |
tgggcagtctctgggatttgcatatatttggtttgtcgaggaagattctgcacaatcagctgcaaaagagatgaatggaaaggtatgcatgcagtgactt |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48661320 |
tgggcagtctctaggatttgcatatatttggtttgtcgaggaagattctgcacaatcagctgcaaaagagatgaatggaaaggtatgcatgcagtgactt |
48661419 |
T |
 |
| Q |
301 |
gtaagtggtatcatgtccatactataaaatgatgatg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48661420 |
gtaagtggtatcatgtccatactataaaatgttgatg |
48661456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University