View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3805_low_27 (Length: 306)
Name: NF3805_low_27
Description: NF3805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3805_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 21 - 295
Target Start/End: Complemental strand, 27313163 - 27312889
Alignment:
| Q |
21 |
ttaaataacataagtttaacctaaccaatcatccattcnnnnnnnncacaatcaaagtttttattgaatggagtagaacaagtatttcaacatgtgacaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27313163 |
ttaaataacataagtttaacctaaccaatcatccattcttttttttcacaatcgaagtttttattgaatggagtagaacaagtatttcaacatgtgacaa |
27313064 |
T |
 |
| Q |
121 |
tgatccactcttgcaattaactacacaggaaacaaaagatcagaggatcgttcgtcatcatcgttgtcgatatcaactcccaaacacttcataggagatt |
220 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27313063 |
tcatccactcttgcaattaactacacaggaaacaaaagatcagaggatcgttcgtcatcatcgttgtcgatatcaactcccaaacacttcataggagatt |
27312964 |
T |
 |
| Q |
221 |
ttctcaccgatttgttattccaactattcctaagaaaccctaaataattctcttcttcttcacttccaaaccttt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
27312963 |
ttctcaccgatttgttattccaactattcctaagaaaccctaagtaattctcttcttcctcacttccaaaccttt |
27312889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University