View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3805_low_29 (Length: 304)
Name: NF3805_low_29
Description: NF3805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3805_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 278
Target Start/End: Complemental strand, 13514725 - 13514465
Alignment:
| Q |
18 |
gtattaaaatgcaaggtaagaaataacaaataatggtcgtaatgtgtggtttatgaatgtagttatggctagtatttataggaactgaagttgtattatt |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13514725 |
gtattaaaatgctaggtaagaaataacaaataatggtcgtaatgtgtggtttatgaatgtagttatggctagtatttataggaactgaagttgtattatt |
13514626 |
T |
 |
| Q |
118 |
tagacnnnnnnnggtacagtattgtttggactttagattgctaattagataaagatgatgactaactaatatcaggttgttggaaccattttattattca |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13514625 |
tagactttttttggtacagtattgtttggactttagattgctaattagataaagatgatgactaactaatatcaggttgttggaaccattttattattca |
13514526 |
T |
 |
| Q |
218 |
cattgagaaatgaattttaaagnnnnnnnttatttgggttcacaaaattcttgatatacta |
278 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13514525 |
cattgagatatgaattttaaagaaaaaaattatttgggttcacaaaattcttgatatacta |
13514465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University