View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3805_low_41 (Length: 211)
Name: NF3805_low_41
Description: NF3805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3805_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 27313069 - 27312889
Alignment:
| Q |
20 |
tgacaatgatccactcttgcaattaactacacaggaaacaaaagatcagaggatcgttcgtcatcatcgttgtcgatatcaactcccaaacacttcatag |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27313069 |
tgacaatcatccactcttgcaattaactacacaggaaacaaaagatcagaggatcgttcgtcatcatcgttgtcgatatcaactcccaaacacttcatag |
27312970 |
T |
 |
| Q |
120 |
gagattttctcaccgatttgttattccaactattcctaagaaaccctaaataattctcttcttcttcacttccaaaccttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
27312969 |
gagattttctcaccgatttgttattccaactattcctaagaaaccctaagtaattctcttcttcctcacttccaaaccttt |
27312889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University