View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3805_low_7 (Length: 485)
Name: NF3805_low_7
Description: NF3805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3805_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 7e-78; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 276 - 466
Target Start/End: Complemental strand, 5569512 - 5569321
Alignment:
| Q |
276 |
caatacaccgcccgtctacaccaacattatcgagtttggtgcgtgagtctaaattgtaggtgacacaaatattatttaataccatattatatttttatac |
375 |
Q |
| |
|
||||| |||| |||||||||||||||||||| |||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5569512 |
caatataccgtccgtctacaccaacattatccagtttgatgtgtgaatctaaattgtaggtgacacaaatattatttaataccatattatatttttatac |
5569413 |
T |
|
| Q |
376 |
taagtcacatccatccttacaaaattgtctttt-agtgatgattgtgactctttttatgttcactgcagactctatctttattctatatttg |
466 |
Q |
| |
|
| ||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5569412 |
tgagtcacacccattcttacaaaattgtcttttaagtgatgattgtgactctttttatgttcactgcagactctatctttattctatatttg |
5569321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 5569783 - 5569695
Alignment:
| Q |
1 |
caaccggaagagttaccaatgggggaacggaaattgacataattggtaacaattataggcaccattacaagctcatttgttaattattg |
89 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5569783 |
caaccggaagatttaccaatggggcaacggaaattgacataattggtaacaattataggcaccattacaagctcatttgttaattattg |
5569695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 156 - 205
Target Start/End: Complemental strand, 5569628 - 5569578
Alignment:
| Q |
156 |
attatattggatctaactcattcttat-aaaacaagtatgaaagataagca |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
5569628 |
attatattggatctaactcattcttataaaaataagtatgaaaaataagca |
5569578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University