View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3806_low_28 (Length: 260)
Name: NF3806_low_28
Description: NF3806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3806_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 18 - 158
Target Start/End: Complemental strand, 941926 - 941786
Alignment:
| Q |
18 |
cgaagaattcgagagttagtgaaaaaggactagtatgtcaatttcaaccatattggtgcgagggaaattttttgtgtagattgacttataaacttcagtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
941926 |
cgaagaattcgagagttagtgaaaaaggactagtatgtcaatttcaaccatattggtgcgagggaaattttttgtgtagattgacttataaacttcagtc |
941827 |
T |
 |
| Q |
118 |
ttatcttgaacaatgtggatctactcatccttcactctttc |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
941826 |
ttatcttgaacaatgtggatctactcatccttcactctttc |
941786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 174 - 247
Target Start/End: Complemental strand, 941762 - 941689
Alignment:
| Q |
174 |
ctcatccttcacaatattcatttggatgagttgaagatctcttagttgatgatacctctgaagtcacttcccct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
941762 |
ctcatccttcacaatattcatttggatgagttgaagatctcttagttgatgatacctctgaagtcacttcccct |
941689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University