View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3806_low_30 (Length: 248)
Name: NF3806_low_30
Description: NF3806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3806_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 41719139 - 41718924
Alignment:
| Q |
19 |
catgtcggacaccaacttgcctttgattacattcaattacttaannnnnnncnnnnnnnn-tccggtgtcaacgtgtgtctggtgtccgtgtctctctca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41719139 |
catgtcggacaccaacttgcctttgattacattcaattacttaatttttttcaaaaaaaaatctggtgtcaacgtgtgtctggtgtccgtgtctccctca |
41719040 |
T |
|
| Q |
118 |
gtgcttcatacatgtcaggttaaacttaaggttttttatttccaaaatatgatgagtggaa-nnnnnnnnnnnnnnngtgaaacttaatttgttacatga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41719039 |
gtgcttcatacatgtcaggttaaacttaaggttttttatttccaaaatatgatgagtggaactttttttttgttgttgtgaaacttaatttgttacatga |
41718940 |
T |
|
| Q |
217 |
tgtgaatattgttcat |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41718939 |
tgtgaatattgttcat |
41718924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 178
Target Start/End: Complemental strand, 41718857 - 41718785
Alignment:
| Q |
105 |
cgtgtctctctcagtgcttcatacatgtcaggttaaacttaaggttttttatttccaaaatatgatgagtggaa |
178 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
41718857 |
cgtgtgtctctcagtgcttcgtacatgtcaagttaaa-ttaagtttttttattgccaaaatatgatgagtggaa |
41718785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University