View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3806_low_31 (Length: 243)
Name: NF3806_low_31
Description: NF3806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3806_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 5684839 - 5685048
Alignment:
| Q |
15 |
cagagacattacaggatgataatcctgctaaacagtttgatactttgttgtatttggcttttcagcatccttcgtgtgagagaacgaagcagaagcatgt |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684839 |
cagagacattagaggatgataatcctgctaaacagtttgatactttgttgtatttggcttttcagcatccttcgtgtgagagaacgaagcagaagcatgt |
5684938 |
T |
|
| Q |
115 |
taggtctgggcattccaggttgtttttcttagggcaatatgtgctggaattggcattggctgaattctttttgcagaggtatccgagggaattgcctggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684939 |
taggtctgggcattccaggttgtttttcttagggcaatatgtgctggaattggcattggctgaattctttttgcagaggtatccgagggaattgcctggt |
5685038 |
T |
|
| Q |
215 |
ccgatgaggg |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
5685039 |
ccgatgaggg |
5685048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 84
Target Start/End: Complemental strand, 39772691 - 39772639
Alignment:
| Q |
32 |
gataatcctgctaaacagtttgatactttgttgtatttggcttttcagcatcc |
84 |
Q |
| |
|
||||| |||||||| || |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
39772691 |
gataaccctgctaagcaatttgatacgctgttgtatttggcgtttcagcatcc |
39772639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University