View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3806_low_33 (Length: 237)
Name: NF3806_low_33
Description: NF3806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3806_low_33 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 23692566 - 23692346
Alignment:
| Q |
1 |
tgaaaccatatcaaccatcccaactgtacgtttagataatattttataaccattgaatatactcaatatcctttccatttatcctatcattgctaattcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23692566 |
tgaaaccatatcaaccatcccaactgtacgtttagataatattttataaccattgaatatactcaatatcctttccatttatcctatcattgctaattcc |
23692467 |
T |
 |
| Q |
101 |
atgtgtccttttatgcctgcagccaacactatctattttctgtgagaatgaacctgatattcaatcttggctcacaccaggaaaaagagttgcatatgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
23692466 |
atgtgtccttttatgcctgcagccaacactatctactttctgtgagaatgaacctgatattcaatcttcgctcacactaggaaaaagagttgcatatgaa |
23692367 |
T |
 |
| Q |
201 |
cttcctaccaaagatttcgaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23692366 |
cttcctaccaaagatttcgaa |
23692346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 221
Target Start/End: Complemental strand, 122621 - 122539
Alignment:
| Q |
139 |
tctgtgagaatgaacctgatattcaatcttggctcacaccaggaaaaagagttgcatatgaacttcctaccaaagatttcgaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||| ||||| | |||||||||| | ||||||||| |
|
|
| T |
122621 |
tctgtgagaatgaacctgatattcaatctgcactcacaccagggaaaagaattgcagactcacttcctaccgatgatttcgaa |
122539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University