View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3808_high_15 (Length: 311)
Name: NF3808_high_15
Description: NF3808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3808_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 21445410 - 21445715
Alignment:
| Q |
1 |
agcttggtctttaactcatagtcatcatctgtccaataaccattttccaacacatcttccattgcaagatcgtcgtactcttcatcagacttcgttgatt |
100 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445410 |
agcttggtctttaactcgtaatcatcatctgtccaataaccattttccaacacatcttccattgcaagatcgtcgtactcttcatcagacttcgttgatt |
21445509 |
T |
|
| Q |
101 |
cctcgtctacagatccaacctggagcgcaaaatacaaaaggactcaaaattagttaaaagtactactatgtgtagcatcgatactttcagattgaaaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445510 |
cctcgtctacagatccaacctggagcgcaaaatacaaaaggactcaaaattagttaaaagtactactatgtgtagcatcgatactttcagattgaaaatg |
21445609 |
T |
|
| Q |
201 |
tgtcaaatgtctgacaccgaccgacacaccaccgatactctagtttacattgagttgatttcatattctcaaattattatcagtgttgtctagagtctgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445610 |
tgtcaaatgtctgacaccgaccgacacaccaccgatactctagtttacattgagttgatttcatattctcaaattattatcagtgttgtctagagtctgt |
21445709 |
T |
|
| Q |
301 |
ggtgct |
306 |
Q |
| |
|
|||||| |
|
|
| T |
21445710 |
ggtgct |
21445715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 107
Target Start/End: Complemental strand, 40686896 - 40686811
Alignment:
| Q |
22 |
tcatcatctgtccaataaccattttccaacacatcttccattgcaagatcgtcgtactcttcatcagacttcgttgattcctcgtc |
107 |
Q |
| |
|
|||||||||| |||||| ||| |||| |||||||| |||||| | ||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
40686896 |
tcatcatctgaccaatatccactttcaggcacatcttgcattgccaaatcatcatactcttcatcagacttggttgattcctcgtc |
40686811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University