View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3808_high_16 (Length: 303)
Name: NF3808_high_16
Description: NF3808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3808_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 8e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 80 - 209
Target Start/End: Original strand, 55448373 - 55448503
Alignment:
| Q |
80 |
aatacttcatgattgattaatcgtgtttgttttagcaataataataatatgggattagctagctagttagggtttcccgatatcgaatggaatgg-aagc |
178 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55448373 |
aatactccatgattgattaatcgtgtttgttttagcaataataataatatgggattagctagctagttagggtttcccgatatcgaatggaatggaaagc |
55448472 |
T |
|
| Q |
179 |
aaagaaagaacaaaccccccttcattgtttg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
55448473 |
aaagaaagaacaaaccccccttcattgtttg |
55448503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 232 - 274
Target Start/End: Original strand, 55448526 - 55448568
Alignment:
| Q |
232 |
ggactactgctatttttggatggagcagcctgttgttgttact |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55448526 |
ggactactgctatttttggatggagcagcctgttgttgttact |
55448568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 56
Target Start/End: Original strand, 55448287 - 55448321
Alignment:
| Q |
22 |
atcatcatgttctccacatctctcaggtagttagg |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
55448287 |
atcatcatgttctccacatctctcaggtagttagg |
55448321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University