View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3808_low_2 (Length: 267)
Name: NF3808_low_2
Description: NF3808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3808_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 261
Target Start/End: Complemental strand, 39173763 - 39173521
Alignment:
| Q |
19 |
attatgagatatattggtctagatctagtgttgaatttgtaagttttcgatggttatactttgttgttttatgataaaactgatgatgtttcctttagcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39173763 |
attatgagatatattggtctagatctagtgttgaatttgtaagttttcgatggttatacttctttgttttatgataaaactgatgatgtttcctttagcc |
39173664 |
T |
|
| Q |
119 |
tctttgcaaaccttggaagatttgtacacgggaagttccttgtaagtgaggtcatatcttgctaatgttctgattgcatttcttaaccatgagatatatt |
218 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39173663 |
tctttgcgaaccttggaagatttgtacacgggaagttccttgtaagtgaagtcatatcttgctaatgttctgattgcatttcttaatcatgagatatatt |
39173564 |
T |
|
| Q |
219 |
acttttaactttgtatcataactcagttttcacttcatctcac |
261 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39173563 |
actttaaactttgtatcataactcagttttcacttcatctcac |
39173521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 39169819 - 39169651
Alignment:
| Q |
19 |
attatgagatatattggtctagatctagtgttgaatttgtaagttttcgatggttatactttgttgttttatgataaaactgatgatgtttcctttagcc |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39169819 |
attatgagacatattggtctagatctagtgttgaatttgtacgttttcgatggttatacttctttgttttatgataaaactgatgatgtttcctttagcc |
39169720 |
T |
|
| Q |
119 |
tctttgcaaaccttggaagatttgtacacgggaagttccttgtaagtgaggtcatatcttgctaatgtt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
39169719 |
tctttgcaaaccttggaagatttgtacacgggaggttccttgtagttgaggtcatatcttgctaatgtt |
39169651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 201
Target Start/End: Complemental strand, 39178808 - 39178734
Alignment:
| Q |
127 |
aaccttggaagatttgtacacgggaagttccttgtaagtgaggtcatatcttgctaatgttctgattgcatttct |
201 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
39178808 |
aaccttggaagatttgtacatgggaggttccttgtacgtgaggacatatcttgctaatgttgtgattgcatttct |
39178734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 219 - 261
Target Start/End: Complemental strand, 39169160 - 39169118
Alignment:
| Q |
219 |
acttttaactttgtatcataactcagttttcacttcatctcac |
261 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39169160 |
acttctaactttgtatcataactcagttttcacttcatctcac |
39169118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University