View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3809_high_4 (Length: 222)
Name: NF3809_high_4
Description: NF3809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3809_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 2248139 - 2247965
Alignment:
| Q |
19 |
atgtcttgtttagatgataaattggttgatcgaattgactcttacgaaattcgaagcataatcaatgttcggtgtaataatttggacatttttgccggag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2248139 |
atgtcttgtttagatgataaattggttgatcgaattgagtcttacgaaattcgaaccataatcattgttcggtgtaataatttggacatttttgccggag |
2248040 |
T |
|
| Q |
119 |
ttaaggtttatctcaaacttttggaagaatgaaatccttctagtcgatcttaagtggaattggttgtttactaaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2248039 |
ttaaggtttatctcaaacttttggaagaatgaaatccttctagtcgatcttaagtggaattggttgtttactaaa |
2247965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University