View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3809_low_4 (Length: 222)

Name: NF3809_low_4
Description: NF3809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3809_low_4
NF3809_low_4
[»] chr2 (1 HSPs)
chr2 (19-193)||(2247965-2248139)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 2248139 - 2247965
Alignment:
19 atgtcttgtttagatgataaattggttgatcgaattgactcttacgaaattcgaagcataatcaatgttcggtgtaataatttggacatttttgccggag 118  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
2248139 atgtcttgtttagatgataaattggttgatcgaattgagtcttacgaaattcgaaccataatcattgttcggtgtaataatttggacatttttgccggag 2248040  T
119 ttaaggtttatctcaaacttttggaagaatgaaatccttctagtcgatcttaagtggaattggttgtttactaaa 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2248039 ttaaggtttatctcaaacttttggaagaatgaaatccttctagtcgatcttaagtggaattggttgtttactaaa 2247965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University