View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3810_high_14 (Length: 265)
Name: NF3810_high_14
Description: NF3810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3810_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 2137951 - 2137732
Alignment:
| Q |
11 |
cacagaactagaagctggattgaatcgcatcactgaaacagtggcaaaaaaccacttagaagtcctagctgagatagatcgacttacgaaggcctttgag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2137951 |
cacagaactagaagctggattgaatcgcatcactgaaacagtggcaaaaaaccacttagaagtcctagccgagatagatcgacttacgaaggcctttgag |
2137852 |
T |
 |
| Q |
111 |
acacttcagcaagggaacacgccgtttcaagagtcatccgatgctactgtgatcaactcaaccaaacagtcggtgagatatgttaaactttatgatttct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2137851 |
acacttcagcaagggaacacgccgtttcaagagtcatcccatgctactgtgatcaactcaaccaaacagtcggtgagatatgttaaacttgatgatttct |
2137752 |
T |
 |
| Q |
211 |
aaaatgttatgaatttgatt |
230 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
2137751 |
aaaattttatgaatttgatt |
2137732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 233 - 265
Target Start/End: Complemental strand, 2137701 - 2137669
Alignment:
| Q |
233 |
attgaatttataagacatattacagttcaaaat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2137701 |
attgaatttataagacatattacagttcaaaat |
2137669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University