View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3810_high_15 (Length: 258)
Name: NF3810_high_15
Description: NF3810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3810_high_15 |
 | |
|
| [»] scaffold0330 (1 HSPs) |
| | |
|
| [»] scaffold0240 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 241
Target Start/End: Complemental strand, 13107214 - 13106981
Alignment:
| Q |
8 |
aaattattctaatctttctctcgattctgtatgtgcatgttttatcatagagtacttatcgagaacgtataatggtttagagaaaaatgaaaagggtaaa |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13107214 |
aaatcattctaatctttctctcgattctgtatgtgcatgttttatcgtagagtacttatccagaatgtataatggtttagagaaaaatgaaaagggtaaa |
13107115 |
T |
|
| Q |
108 |
ctgttgtttttggttcttgaatgtgagatacgttgccactataatctttgtacatgaaaattgttgatacatccatgagtgtatcttttattggcttttt |
207 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13107114 |
ccgttgtttttggttcttgaatgtgagatacgttgccactataatctttgtacatgaaaattgttgatacatccatgagtgtatcttttattggcttttt |
13107015 |
T |
|
| Q |
208 |
agtcctcggatctatgttttgtttagtcaattta |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13107014 |
agtcctcggatctatgttttgtttagtcaattta |
13106981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 17023 - 16982
Alignment:
| Q |
13 |
attctaatctttctctcgattctgtatgtgcatgttttatca |
54 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
17023 |
attctaatctttctcttgattctgtatgtgcatgttctatca |
16982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0240 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0240
Description:
Target: scaffold0240; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 1041 - 1000
Alignment:
| Q |
13 |
attctaatctttctctcgattctgtatgtgcatgttttatca |
54 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
1041 |
attctaatctttctcttgattctgtatgtgcatgttctatca |
1000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 37747719 - 37747678
Alignment:
| Q |
13 |
attctaatctttctctcgattctgtatgtgcatgttttatca |
54 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
37747719 |
attctaatctttctctcgattatgtatgtgcatgttctatca |
37747678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 37749284 - 37749243
Alignment:
| Q |
13 |
attctaatctttctctcgattctgtatgtgcatgttttatca |
54 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
37749284 |
attctaatctttctctcaattatgtatgtgcatgttctatca |
37749243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 13 - 48
Target Start/End: Complemental strand, 34486326 - 34486291
Alignment:
| Q |
13 |
attctaatctttctctcgattctgtatgtgcatgtt |
48 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34486326 |
attctaatctttctctcgattatgtatgtgcatgtt |
34486291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University