View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3810_high_16 (Length: 247)
Name: NF3810_high_16
Description: NF3810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3810_high_16 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 81 - 247
Target Start/End: Original strand, 8985553 - 8985717
Alignment:
| Q |
81 |
aaaaatcacgtttgattttaaaaaagtcttgaaattaaacttgtttcataatttaaaatacttagaatgtaaataatctgcttcttgagttggaacaagg |
180 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8985553 |
aaaaatcacgtttgattttaaaaatgtcttgaaattaaacttgtttcataaattaaaatacttagaatgtaaataatctgcttcttgagttggaacaa-g |
8985651 |
T |
 |
| Q |
181 |
gggatatagcgatatagcagcgtgtggaagcctttttcgtaatttagatggacggtagatcaaaggt |
247 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| |||||||||||||| || | |||||||||| |
|
|
| T |
8985652 |
gggaaatagcgatatagcagcgtgt-gaagccttttacgtaatttagatgggcgatggatcaaaggt |
8985717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 17 - 86
Target Start/End: Original strand, 8979793 - 8979862
Alignment:
| Q |
17 |
atttgtaatacaagaagaatcctctttgaatttgtaaagtggtcgaatgtaaatgatttgaataaaaaat |
86 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8979793 |
atttgtaatacaagaagaatcatctttgaatttgtaaagtggtcgaatgtaaatgatttgaataaaaaat |
8979862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University