View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3810_high_17 (Length: 247)
Name: NF3810_high_17
Description: NF3810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3810_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 114 - 229
Target Start/End: Complemental strand, 2756976 - 2756861
Alignment:
| Q |
114 |
gtaacacaactgcaacatgggtcatggtggaggagaagctgaagaaggaagagatttgcaatttacacctacatgggttgttgctcttgtttgcactgtc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2756976 |
gtaacacaactgcaacatgggtcatggtggaggagaagctgaagaaggaagagatttgcaatttacacctacatgggttgttgctcttgtttgcactgtc |
2756877 |
T |
|
| Q |
214 |
atcgtcgctgtttcat |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2756876 |
atcgtcgctgtttcat |
2756861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 2757050 - 2756974
Alignment:
| Q |
1 |
agaacaagaaatagtgcagtagttgttgttttttatgtcccatgtcacagttgtaacataaaacacaacaaagagta |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2757050 |
agaacaagaaatagtgcagtagttgttgttttttatgtcccatgttgcagttgtaacataaaacacaacaaagagta |
2756974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 82 - 229
Target Start/End: Complemental strand, 2748944 - 2748796
Alignment:
| Q |
82 |
agtaagttaacgttgttcaaatcaaacattgtgtaacacaactgcaacatgggtcatggtggaggagaagctgaagaaggaagagatttgcaatttacac |
181 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| ||||||| | |||||||||||||||||||||| ||| |||||||||| |||||||||| | | | |
|
|
| T |
2748944 |
agtaagttaatattgttcaaatcaaacactgtttaacacagttacaacatgggtcatggtggaggacaagttgaagaaggacccgatttgcaatatgctc |
2748845 |
T |
|
| Q |
182 |
ctacatgggttgttgctcttgtttgcactgtcatc-gtcgctgtttcat |
229 |
Q |
| |
|
|||||||| ||||||| |||||||||| |||||| ||||| ||||||| |
|
|
| T |
2748844 |
ctacatggattgttgcccttgtttgcagcgtcatcggtcgcagtttcat |
2748796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University