View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3810_high_18 (Length: 240)
Name: NF3810_high_18
Description: NF3810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3810_high_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 36611895 - 36611675
Alignment:
| Q |
18 |
gtgtgagtgtctgtttagtgattggtgtttgtgcttcatagcttgtttatcttgtttgttgtttgataatatgaagtggtgtagttgattttgggaattg |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36611895 |
gtgtgagtgtct--ttagtgattggtgtttgtgcttcatagcttgtttatcttgtttgttgtttgataatatgaagtggtgtagttgattttgggaattg |
36611798 |
T |
 |
| Q |
118 |
tatttgtagatggctctaattgcgagaattaagcatccttacattgttgaattcaaggaggcttgggttgagaaggtgagatacaccactagatgcttga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36611797 |
tatttgtagatggctctaattgcgagaattaagcatccttacattgttgaattcaaggaggcttgggttgagaaggtgagatacaccactagatccttga |
36611698 |
T |
 |
| Q |
218 |
ctttatgtgtgtatctttgtttt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36611697 |
ctttatgtgtgtatctttgtttt |
36611675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 124 - 200
Target Start/End: Original strand, 18641448 - 18641524
Alignment:
| Q |
124 |
tagatggctctaattgcgagaattaagcatccttacattgttgaattcaaggaggcttgggttgagaaggtgagata |
200 |
Q |
| |
|
||||||||||| ||||| ||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18641448 |
tagatggctcttattgcaagaatcaggcacccttacattgttgaattcaaggaggcttgggttgagaaggtgagata |
18641524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University