View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3812_low_13 (Length: 267)

Name: NF3812_low_13
Description: NF3812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3812_low_13
NF3812_low_13
[»] chr4 (1 HSPs)
chr4 (25-257)||(22357768-22358001)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 25 - 257
Target Start/End: Original strand, 22357768 - 22358001
Alignment:
25 tcaatctcagtggaatatcagcagttgaagcttctggaattgaaacagatatcttgagttcaatagatgttatgttatgaatataatgatcagtggaagt 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
22357768 tcaatctcagtggaatatcagcagttgaagcttctggaattgaaacagatatcttgagttcaatagatgttatgttatgaatataatgatcggtggaagt 22357867  T
125 ccattcatttagccttccgtgtaactttcattggtgggtgactgtac-nnnnnnnngtcacatgagagaaaaaagaaagcaactatatagagacaagaaa 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||    
22357868 ccattcatttagccttccgtgtaactttcattggtgggtgactgtactttttttttgtcacatgagagaaaaaagaaagcaactatatagagacaagaaa 22357967  T
224 attgctcatgcaccctcacaagatgtcccctatg 257  Q
    |||||| |||||||||||||||||||||||||||    
22357968 attgctaatgcaccctcacaagatgtcccctatg 22358001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University