View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3812_low_13 (Length: 267)
Name: NF3812_low_13
Description: NF3812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3812_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 25 - 257
Target Start/End: Original strand, 22357768 - 22358001
Alignment:
| Q |
25 |
tcaatctcagtggaatatcagcagttgaagcttctggaattgaaacagatatcttgagttcaatagatgttatgttatgaatataatgatcagtggaagt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22357768 |
tcaatctcagtggaatatcagcagttgaagcttctggaattgaaacagatatcttgagttcaatagatgttatgttatgaatataatgatcggtggaagt |
22357867 |
T |
 |
| Q |
125 |
ccattcatttagccttccgtgtaactttcattggtgggtgactgtac-nnnnnnnngtcacatgagagaaaaaagaaagcaactatatagagacaagaaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22357868 |
ccattcatttagccttccgtgtaactttcattggtgggtgactgtactttttttttgtcacatgagagaaaaaagaaagcaactatatagagacaagaaa |
22357967 |
T |
 |
| Q |
224 |
attgctcatgcaccctcacaagatgtcccctatg |
257 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
22357968 |
attgctaatgcaccctcacaagatgtcccctatg |
22358001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University