View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3812_low_17 (Length: 256)
Name: NF3812_low_17
Description: NF3812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3812_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 26 - 189
Target Start/End: Complemental strand, 28094641 - 28094475
Alignment:
| Q |
26 |
gtaggtaataaatg---tcaccatggattagaaatggatattttgtgtcttcttgagacatttatttatggtgcaactatgattgatttatacaatatca |
122 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28094641 |
gtaggtaataaatgccaccaccatggattagaaatggatattttgtgtcttcttgagacatttatttatggtgcaactatgattgatttatacaatatca |
28094542 |
T |
|
| Q |
123 |
atgtgattcccatactatgattcacattattattattatttttgcggagggcaaggggaatatgcat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
28094541 |
atgtgattcccatactatgattcacattattattattatttttgcggagagcgaagggaatatgcat |
28094475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University