View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3813_high_10 (Length: 543)
Name: NF3813_high_10
Description: NF3813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3813_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-147; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-147
Query Start/End: Original strand, 139 - 407
Target Start/End: Original strand, 38371855 - 38372123
Alignment:
| Q |
139 |
aactgatgtagccgacactttgtttgatggtggcaaaggtggttttattttcttcaaggtttgggttatgagaccgttaaagaattttggtgttttttat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38371855 |
aactgatgtagccgacactttgtttgatggtggcaaaggtggttttattttcttcaaggtttgggttatgagaccgttaaagaattttggtgttttttat |
38371954 |
T |
 |
| Q |
239 |
agtacattgcaatgcaaggggtccaccccaacaaatatctgtttggacgttattacccttttgttaggagtatatttagggaagttgccactgtgttggg |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38371955 |
agtacattgcaatgcaaggggtccaccccaacaaatatctgtttggacgttattacccttttgttaggagtatatttagggaagttgccactgtgttggg |
38372054 |
T |
 |
| Q |
339 |
tcccattggcggttgtgtgtgtcgttaggcagagcagaatgcatatgcaacagaaatggttttgttctt |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38372055 |
tcccattggcggttgtgtgtgtcgttaggcagaacagaatgcatatgcaacagaaatggttttgttctt |
38372123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 38371723 - 38371834
Alignment:
| Q |
1 |
gaaacaaagtggagaaacagtggtgcttcattctgattgaagacgataatgcgtaatgcaccgctgcaattgtcagctccggtaaattcggagaccaggg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
38371723 |
gaaacaaagtggagaaacggtggtgcttcattctgattgaagacgataatgcgtaatgcaccgccgcaattgtcagctccggtaaattcggagaccagcg |
38371822 |
T |
 |
| Q |
101 |
aaaatagttgac |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38371823 |
aaaatagttgac |
38371834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 457 - 526
Target Start/End: Original strand, 38372200 - 38372269
Alignment:
| Q |
457 |
taccgttaacccgttatagttgttgaagagacggaaacggtggaattaacgagaaggaaaatgaggcaat |
526 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
38372200 |
taccgttaacccgttatagttgttcaagagacggaaacggtcgaattaattagaaggaaaatgaggcaat |
38372269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University