View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3813_high_38 (Length: 295)
Name: NF3813_high_38
Description: NF3813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3813_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 44515412 - 44515692
Alignment:
| Q |
1 |
ttgtttcttgtgttgaaagcgtgatcaattgcgcccttaggcctgaagatccaattgagctttctacacaatacgcagtaaaccgttttgcacgtcaacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44515412 |
ttgtttcttgtgttgaaagcgtgatcaattgcgcccttaggcctgaagatccaattgagctttctacacaatacgtagtaaaccgttttgcacgtcaacg |
44515511 |
T |
 |
| Q |
101 |
gttggagggaatgtgtaaaacgagtgaaggtaatataca---------cattgaggatgtggttggtggctttacttgtgaggaagtacttcgtactata |
191 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44515512 |
gttggagggaatgtgtaaaatgagtgaaggtaatatacacattgagtgcattgaggatgtggttggtggctttacttgcgaggaagtacttcgtactata |
44515611 |
T |
 |
| Q |
192 |
agagataatggcattccgactgaaaaggccttcaaatatactggactacctgtggtttcttatgcaaatgagtggaagaca |
272 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44515612 |
agagatagtggcattccgactgaaaaggccttcaaatatactggactacctgtggtttcttatgcaaatgagtggaagaca |
44515692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University