View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3813_high_55 (Length: 242)
Name: NF3813_high_55
Description: NF3813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3813_high_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 14051214 - 14051318
Alignment:
| Q |
1 |
ttgtaaagatgttacttttac-tttgatcctcaagttgagtgtttgtttgcagaagtaacnnnnnnnnccatccaatgaaatcggtacatttttattatt |
99 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
14051214 |
ttgtaaagatgttacctttacctttgatcctcaagttgagtgtttgtttgcagaagtaactgttttttccatccagtgaaataggtacatttttattatt |
14051313 |
T |
|
| Q |
100 |
attgc |
104 |
Q |
| |
|
||||| |
|
|
| T |
14051314 |
attgc |
14051318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 193 - 240
Target Start/End: Original strand, 14051407 - 14051454
Alignment:
| Q |
193 |
caggattttggtggtgactggattaaatagaagtgtttggtgtctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14051407 |
caggattttggtggtgactggattaaatagaagtgtttggtgtctctg |
14051454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University