View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3813_high_56 (Length: 239)
Name: NF3813_high_56
Description: NF3813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3813_high_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37666253 - 37666030
Alignment:
| Q |
1 |
acacatatattaacaaacccattttagattgttagtaattactagaccatacacaaactcagaaaagttgtatgcatgtatgaaatcacggtgaatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37666253 |
acacatatattaacaaacccattttagattgttagtaattactataccatacacaaactcagaaaagttgtatgcatgtatgaaatcacggtgaatttga |
37666154 |
T |
|
| Q |
101 |
caaaatcacaatgactccgtcaaactcattgtgagttcaaacatgcatagtatataggatctatgaaagagtagaatattgctttggttagact-aagca |
199 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| | ||||| |
|
|
| T |
37666153 |
caaaatcacattgactcggtcaaactcattgtgagttcaaacatgcatagtatataggatctatgaaagagtagaatatggctttagttagattaaagca |
37666054 |
T |
|
| Q |
200 |
tacccgaggaggaattgaaggctg |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37666053 |
tacccgaggaggaattgaaggctg |
37666030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 33901485 - 33901449
Alignment:
| Q |
72 |
atgcatgtatgaaatcacggtgaatttgacaaaatca |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33901485 |
atgcatgtctgaaatcacggtgaatttgacaaaatca |
33901449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University