View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3813_low_31 (Length: 351)
Name: NF3813_low_31
Description: NF3813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3813_low_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 87 - 351
Target Start/End: Complemental strand, 38207330 - 38207069
Alignment:
| Q |
87 |
gtgtgtgttgaagatattgttacaaaatttctggaaaatgagcatgggttcacaagtattactgaaaagttacactctttatttcatttttattattann |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38207330 |
gtgtgtgttgaagatattgttacaaaatttctggaaaatgagcatgggttcacaagtattacttaaaagttacactctttatttcatttttattatt--- |
38207234 |
T |
 |
| Q |
187 |
nnnnnnnnnnnnnnncaaatgctgcttaaaagataaattagctttatatttagttaatcatttgtataagttcattcctagatttttattagtcaccttt |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38207233 |
ttttttttcttttttcaaatgctgcttaaaagataaattagctttatatttagttaatcctttgtataagttcattcctagatttttattagtcaccttt |
38207134 |
T |
 |
| Q |
287 |
gtaattaattagttgcttgatgagtagtgtgtattcagcctactagacgcttcttctagaaggtg |
351 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
38207133 |
gtaattaattagttgcttgctgagtagtgtgtattaagcctactagacacttcttatagaaggtg |
38207069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University