View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3813_low_47 (Length: 253)

Name: NF3813_low_47
Description: NF3813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3813_low_47
NF3813_low_47
[»] chr6 (1 HSPs)
chr6 (192-253)||(31268764-31268825)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 192 - 253
Target Start/End: Original strand, 31268764 - 31268825
Alignment:
192 agtggttttgccaacaggattgaatctaacagaaaaggttagacgtaaattatggcttaaat 253  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
31268764 agtggttttgccaacaggattgaatctaaaagaaaaggttagacgtaaattatggcttaaat 31268825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University