View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3813_low_50 (Length: 250)

Name: NF3813_low_50
Description: NF3813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3813_low_50
NF3813_low_50
[»] chr5 (1 HSPs)
chr5 (1-239)||(2900450-2900689)


Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 2900689 - 2900450
Alignment:
1 tatgctatagttcatcatgaggaacaaacacttgcttctcttaacattgcagtggagtaaaacccaaaatgcagttaa-ctcattatgttactttagcgg 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||    
2900689 tatgctatagttcatcatgaggaacaaacacttgcttctcttaacattgcagtggagtaaaacccaaaatgcagttaaactcattatgttactgtagcgg 2900590  T
100 tttagccattaagataaattcatatgagaataaacacttgcaaatggttgataagcgaccgggaaaaataaggtatatatataaactaatatttcaattc 199  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||    
2900589 tttagccattgagataaattcatatgagaataaacacttgcaaatggttgataagcgaccgggaaaaataaagtttatatataaactaatagttcaattc 2900490  T
200 aaactgataattatactgatatactaccgcatccgcctat 239  Q
    ||||||||||||||||||||||||||||||||||||||||    
2900489 aaactgataattatactgatatactaccgcatccgcctat 2900450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University