View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3813_low_57 (Length: 244)
Name: NF3813_low_57
Description: NF3813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3813_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 3 - 239
Target Start/End: Complemental strand, 40271176 - 40270940
Alignment:
| Q |
3 |
aaaaataattttaaactgtatgatcagcctgccagagattctgctggagccattcaaattcagcaacctcacaatgggccattttatgtctctcaacaaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
40271176 |
aaaaataattttaaactgtatgatcagcctgtcagagattctgctggagccattcgaattcagcgacctcacaatgggccattttatgtgtctcaacaaa |
40271077 |
T |
 |
| Q |
103 |
cgattgatgaacacattgaaaatctcaagagtgttgcaaggttgctttactacatagttgcttgttgtgtattttgatcaaagannnnnnnattgactat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40271076 |
cgattgatgaacacattgaaaatctcaagagtgttgcaaggttgctttactacatagttgcttgttgtgtattttgatcaaagatttttttattgactat |
40270977 |
T |
 |
| Q |
203 |
aaaatttattattaggtggtgccagtgtgtttctgtg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40270976 |
aaaatttattattaggtggtgccagtgtgtttctgtg |
40270940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 116
Target Start/End: Complemental strand, 40283776 - 40283712
Alignment:
| Q |
52 |
ccattcaaattcagcaacctcacaatgggccattttatgtctctcaacaaa-cgattgatgaacac |
116 |
Q |
| |
|
|||||| |||||||| ||||| ||| |||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
40283776 |
ccattcgaattcagcgacctcccaaagggccattttatgtctct-agcaaagcgattgatgaacac |
40283712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University