View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3813_low_70 (Length: 213)
Name: NF3813_low_70
Description: NF3813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3813_low_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 113 - 204
Target Start/End: Complemental strand, 7136416 - 7136325
Alignment:
| Q |
113 |
taatgattatgttctttatttgtttcgaataggaaatgggttttttgaaaacattgttaaagaggaagatttgtcgttgttattgttgtgtg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7136416 |
taatgattatgttctttatttgtttcgaataggaaatgggttttttgaaaacattgttaaagaggaagatttgtcgttgttattgttgtgtg |
7136325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 7136532 - 7136481
Alignment:
| Q |
1 |
ctcctaatcctccttccattttctacgatatcagagcccctcttcctggtaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7136532 |
ctcctaatcctccttccattttctacgatatcagagcccctcttcctggtaa |
7136481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University