View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3814_high_13 (Length: 343)
Name: NF3814_high_13
Description: NF3814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3814_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 325
Target Start/End: Complemental strand, 1055364 - 1055050
Alignment:
| Q |
18 |
aagagtgaggttaacgtcgttagtggaacggaaacggaaagtgtgacggtaacggtgagcttgagagggtgagatgaagaaggaagagatggatggagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1055364 |
aagagtgaggttaacgtcgttagtggaacggaaacggaaagtgtgacggtaacggtgagcttgagagggtgagatgaagaaggaggagatggatggagtt |
1055265 |
T |
 |
| Q |
118 |
ggagccatgcaccccatttgcgtgaacggagaagaggacacgatagtacttttacttctctaacctctcttcttttcttttgtgattggtttctttat-- |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1055264 |
ggagccatgcaccccatttgcgtgaacggagaagaggacacgatagtacttttacttctctaacctctcttcttttcttttgtgattggtttctttatta |
1055165 |
T |
 |
| Q |
216 |
-----tattagttattagttttcgttatttcgatttccacgatgacgactttccctcgttttagacggaggtcgctatttgaacccnnnnnnnaggtaat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1055164 |
tttattattagttattagttttcgttatttcgatttccacgatgacgactttccctcgttttagacggaggtcgctatttgaaccctttttttaggtaat |
1055065 |
T |
 |
| Q |
311 |
acacccacatttctt |
325 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1055064 |
acacccacatttctt |
1055050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University