View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3814_high_18 (Length: 254)
Name: NF3814_high_18
Description: NF3814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3814_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 159 - 239
Target Start/End: Complemental strand, 5752355 - 5752275
Alignment:
| Q |
159 |
tcctttccaaatacgggcaagttcacccaatgccaaatcccatcccttttcagtgctctttgcactgatcagattcatccc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
5752355 |
tcctttccaaatacgggcaagttcacccaattccaaatcccaacccttttcagcactctttgcacggatcagattcatccc |
5752275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 19 - 83
Target Start/End: Complemental strand, 5752520 - 5752456
Alignment:
| Q |
19 |
gctgatacctgaattgacagcaagggaaacaactctcctccatgcggtttggcattcaattattt |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5752520 |
gctgatacctgaattgacagcaagggaaacaactctcctccatgcggtttggcgttcaattattt |
5752456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 151
Target Start/End: Complemental strand, 5752452 - 5752399
Alignment:
| Q |
99 |
ttgcgaactttggatccacaagaaggtttgtaagattaggg-ttctgtcgtacg |
151 |
Q |
| |
|
||||||||| |||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
5752452 |
ttgcgaactctggatccacaagaaggttagcgagattagggtttctgtcgtacg |
5752399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University