View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3814_high_27 (Length: 236)
Name: NF3814_high_27
Description: NF3814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3814_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 64 - 221
Target Start/End: Complemental strand, 53120985 - 53120828
Alignment:
| Q |
64 |
atgcaattttgtttaggagtttaacatgaattcaataaggtatgccaagtcattatttttaattcattacnnnnnnnaattaatttagtggctcacacac |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53120985 |
atgcaattttgtttaggagtttaacatgaattcaataaggtatgccaagtcattatttttaattcattactttttttaattaatttagtggctcacacac |
53120886 |
T |
|
| Q |
164 |
cttaaatgtcgnnnnnnngtgtagaatttgaagaccgaatctaacccctcatatcaat |
221 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53120885 |
cttaagtgtcgagaaaaaatgtagaatttgaagaccgaacctaacccctcatatcaat |
53120828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University