View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3814_low_17 (Length: 271)
Name: NF3814_low_17
Description: NF3814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3814_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 27770445 - 27770237
Alignment:
| Q |
17 |
aggaattagatcctctatcctttgagtgtgtg--agagagagggagtgagggtcaggagatcagagatgtagaaagaaacatatgtgtctttcctactat |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
27770445 |
aggaattggatcctctatcctttgagtgtgtgtgagagagagggagggaggg-----agatcagagatgtaaaaagaaa--tatgtgtctttcctactat |
27770353 |
T |
 |
| Q |
115 |
taaggaagatgatccttgtctacaacattactcggttattaattaat---atgattcagaccgttcatgttttgattgagttgaaaccaaagaaaataaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
27770352 |
taaggaagatgatccttgtctacaacatttctcggttattaattaatcagatgattcagaccgttcttgttttgattgagttgaaaccaaacaaaataaa |
27770253 |
T |
 |
| Q |
212 |
atcttgttaattaggt |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27770252 |
atcttgttaattaggt |
27770237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University